Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5’

To find the correct product of DNA-dependent RNA polymerase using the given DNA template strand, we must follow the rules of transcription:

1. Understand the template polarity:
The given DNA template strand is:
3’ - TACATGGCAAATATCCATTCA - 5’

2. Apply complementary base-pairing rules during transcription:
RNA polymerase synthesizes an RNA strand that is complementary to the DNA template strand. In RNA, the base Uracil (U) is used instead of Thymine (T). The base-pairing rules are:
- Adenine (A) in DNA pairs with Uracil (U) in RNA.
- Thymine (T) in DNA pairs with Adenine (A) in RNA.
- Cytosine (C) in DNA pairs with Guanine (G) in RNA.
- Guanine (G) in DNA pairs with Cytosine (C) in RNA.

3. Determine the sequence and direction of the RNA transcript:
Since the template strand is read in the 3’ to 5’ direction, the newly synthesized RNA strand will be built in the antiparallel 5’ to 3’ direction:
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - G - 5’ pairs with RNA 5’ - C - 3’
- Template 3’ - G - 5’ pairs with RNA 5’ - C - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’
- Template 3’ - T - 5’ pairs with RNA 5’ - A - 3’
- Template 3’ - C - 5’ pairs with RNA 5’ - G - 3’
- Template 3’ - A - 5’ pairs with RNA 5’ - U - 3’

Putting it all together, the transcribed RNA sequence is:
5’ - AUGUACCGUUUAUAGGUAAGU - 3’

Therefore, the correct option is 5’AUGUACCGUUUAUAGGUAAGU3’.